Skip to main navigation Skip to search Skip to main content

Abstract

The authors note that an oligonucleotide sequence appeared incorrectly in the SI Appendix. In the SI Appendix, page 2, second full paragraph, line 4, “GGATGGCCTCATCTTTCCAG” should instead appear as “GGGAGAACCGTGAACGCCGA.” The SI Appendix has been corrected online.

Original languageEnglish
Article numbere2118667118
JournalProceedings of the National Academy of Sciences of the United States of America
Volume118
Issue number48
DOIs
StatePublished - Nov 30 2021

Fingerprint

Dive into the research topics of 'Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117)'. Together they form a unique fingerprint.

Cite this