Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117)

Leo I. Volkov; Jeong Sook Kim-Han; Lauren M. Saunders; Deepak Poria; Andrew E.O. Hughes; Vladimir Kefalov; David M. Parichy; Joseph C. Corbo

doi:10.1073/pnas.2118667118

Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117)

Leo I. Volkov, Jeong Sook Kim-Han, Lauren M. Saunders, Deepak Poria, Andrew E.O. Hughes, Vladimir Kefalov, David M. Parichy, Joseph C. Corbo

Research output: Contribution to journal › Comment/debate

Abstract

The authors note that an oligonucleotide sequence appeared incorrectly in the SI Appendix. In the SI Appendix, page 2, second full paragraph, line 4, “GGATGGCCTCATCTTTCCAG” should instead appear as “GGGAGAACCGTGAACGCCGA.” The SI Appendix has been corrected online.

Original language	English
Article number	e2118667118
Journal	Proceedings of the National Academy of Sciences of the United States of America
Volume	118
Issue number	48
DOIs	https://doi.org/10.1073/pnas.2118667118
State	Published - Nov 30 2021

Access to Document

10.1073/pnas.2118667118

Fingerprint

Dive into the research topics of 'Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117)'. Together they form a unique fingerprint.

Cite this

Volkov, L. I., Kim-Han, J. S., Saunders, L. M., Poria, D., Hughes, A. E. O., Kefalov, V., Parichy, D. M., & Corbo, J. C. (2021). Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117). Proceedings of the National Academy of Sciences of the United States of America, 118(48), Article e2118667118. https://doi.org/10.1073/pnas.2118667118

Volkov, Leo I. ; Kim-Han, Jeong Sook ; Saunders, Lauren M. et al. / Erratum : Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117). In: Proceedings of the National Academy of Sciences of the United States of America. 2021 ; Vol. 118, No. 48.

@article{d28deadcb0944b3197d709fd36680fa3,

title = "Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117)",

abstract = "The authors note that an oligonucleotide sequence appeared incorrectly in the SI Appendix. In the SI Appendix, page 2, second full paragraph, line 4, “GGATGGCCTCATCTTTCCAG” should instead appear as “GGGAGAACCGTGAACGCCGA.” The SI Appendix has been corrected online.",

author = "Volkov, {Leo I.} and Kim-Han, {Jeong Sook} and Saunders, {Lauren M.} and Deepak Poria and Hughes, {Andrew E.O.} and Vladimir Kefalov and Parichy, {David M.} and Corbo, {Joseph C.}",

year = "2021",

month = nov,

day = "30",

doi = "10.1073/pnas.2118667118",

language = "English",

volume = "118",

journal = "Proceedings of the National Academy of Sciences of the United States of America",

issn = "0027-8424",

number = "48",

}

Volkov, LI, Kim-Han, JS, Saunders, LM, Poria, D, Hughes, AEO, Kefalov, V, Parichy, DM & Corbo, JC 2021, 'Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117)', Proceedings of the National Academy of Sciences of the United States of America, vol. 118, no. 48, e2118667118. https://doi.org/10.1073/pnas.2118667118

Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117). / Volkov, Leo I.; Kim-Han, Jeong Sook; Saunders, Lauren M. et al.
In: Proceedings of the National Academy of Sciences of the United States of America, Vol. 118, No. 48, e2118667118, 30.11.2021.

Research output: Contribution to journal › Comment/debate

TY - JOUR

T1 - Erratum

T2 - Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117)

AU - Volkov, Leo I.

AU - Kim-Han, Jeong Sook

AU - Saunders, Lauren M.

AU - Poria, Deepak

AU - Hughes, Andrew E.O.

AU - Kefalov, Vladimir

AU - Parichy, David M.

AU - Corbo, Joseph C.

PY - 2021/11/30

Y1 - 2021/11/30

N2 - The authors note that an oligonucleotide sequence appeared incorrectly in the SI Appendix. In the SI Appendix, page 2, second full paragraph, line 4, “GGATGGCCTCATCTTTCCAG” should instead appear as “GGGAGAACCGTGAACGCCGA.” The SI Appendix has been corrected online.

AB - The authors note that an oligonucleotide sequence appeared incorrectly in the SI Appendix. In the SI Appendix, page 2, second full paragraph, line 4, “GGATGGCCTCATCTTTCCAG” should instead appear as “GGGAGAACCGTGAACGCCGA.” The SI Appendix has been corrected online.

UR - http://www.scopus.com/inward/record.url?scp=85121253897&partnerID=8YFLogxK

U2 - 10.1073/pnas.2118667118

DO - 10.1073/pnas.2118667118

M3 - Comment/debate

C2 - 34815349

AN - SCOPUS:85121253897

SN - 0027-8424

VL - 118

JO - Proceedings of the National Academy of Sciences of the United States of America

JF - Proceedings of the National Academy of Sciences of the United States of America

IS - 48

M1 - e2118667118

ER -

Volkov LI, Kim-Han JS, Saunders LM, Poria D, Hughes AEO, Kefalov V et al. Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117). Proceedings of the National Academy of Sciences of the United States of America. 2021 Nov 30;118(48):e2118667118. doi: 10.1073/pnas.2118667118

Erratum: Thyroid hormone receptors mediate two distinct mechanisms of long-wavelength vision (Proceedings of the National Academy of Sciences of the United States of America (2020) 117 (15262-15269) DOI: 10.1073/pnas.1920086117)

Abstract

Access to Document

Other files and links

Fingerprint

Cite this