Erratum: Modified mRNA Vaccines Protect against Zika Virus Infection (Cell (2017) 168(6) (1114–1125.e10)(S0092867417301952)(10.1016/j.cell.2017.02.017))

(Cell 168, 1114–1125; March 9, 2017) Our paper describes a modified mRNA vaccine that protects rodents against Zika virus infection. In the version originally published online, we erroneously described the cap sequence used in the constructs utilized in the experiments described in the paper. The actual sequence used is N7^mGpppG^m. We also changed the description of the process used to make the RNA to reflect that modifications in the RNA are introduced enzymatically, not chemically as previously stated. Finally, the 5’UTR and 3’UTR sequences used to flank the viral sequence were changed to GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC and UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGA, respectively. While the previously reported sequences were correct, this updated version of the 5’UTR sequence removes the T7 promoter and other plasmid sequences that are ultimately not incorporated in the vaccine itself, and therefore more accurately describes the mRNA sequence that investigators would want to generate, should they want to reproduce our studies. Furthermore, in the corrected 3’UTR, “Ts” are converted to “Us” to reflect the fact that it is RNA rather than DNA. All of these errors have now been corrected both online and in the print version., and we regret any inconvenience that they may have caused to the readers.